Repeated DNA Sequences LeetCode Solution

Problem – Repeated DNA Sequences LeetCode Solution

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

• For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

Constraints:

• 1 <= s.length <= 105
• s[i] is either 'A', 'C', 'G', or 'T'.

Repeated DNA Sequences LeetCode Solution in Java

public List<String> findRepeatedDnaSequences(String s) {
    Set seen = new HashSet(), repeated = new HashSet();
    for (int i = 0; i + 9 < s.length(); i++) {
        String ten = s.substring(i, i + 10);
        if (!seen.add(ten))
            repeated.add(ten);
    }
    return new ArrayList(repeated);
}

Repeated DNA Sequences LeetCode Solution in C++

vector<string> findRepeatedDnaSequences(string s) {
    unordered_map<int, int> m;
    vector<string> r;
    int t = 0, i = 0, ss = s.size();
    while (i < 9)
        t = t << 3 | s[i++] & 7;
    while (i < ss)
        if (m[t = t << 3 & 0x3FFFFFFF | s[i++] & 7]++ == 1)
            r.push_back(s.substr(i - 10, 10));
    return r;
}

Repeated DNA Sequences LeetCode Solution in Python

class Solution:
    # @param s, a string
    # @return a list of strings
    def findRepeatedDnaSequences(self, s):
        sequences = collections.defaultdict(int) #set '0' as the default value for non-existing keys
        for i in range(len(s)):
            sequences[s[i:i+10]] += 1#add 1 to the count
        return [key for key, value in sequences.iteritems() if value > 1] #extract the relevant keys

Repeated DNA Sequences LeetCode Solution Review:

In our experience, we suggest you solve this Repeated DNA Sequences LeetCode Solution and gain some new skills from Professionals completely free and we assure you will be worth it.

If you are stuck anywhere between any coding problem, just visit Queslers to get the Repeated DNA Sequences LeetCode Solution

Find on Leetcode

Conclusion:

I hope this Repeated DNA Sequences LeetCode Solution would be useful for you to learn something new from this problem. If it helped you then don’t forget to bookmark our site for more Coding Solutions.

This Problem is intended for audiences of all experiences who are interested in learning about Data Science in a business context; there are no prerequisites.

Keep Learning!

More Coding Solutions >>

LeetCode Solutions

Hacker Rank Solutions

CodeChef Solutions